Clinical and Environmental Reservoirs of Pseudomonas aeruginosa in Rural Tanzania: Implications for Diagnostics and Antimicrobial Stewardship

Article information

Urogenit Tract Infect. 2026;21(2):74-88
Publication date (electronic) : 2026 August 31
doi : https://doi.org/10.14777/uti.2550050025
1Department of Public Health, St. Francis University College of Health and Allied Sciences, Ifakara, Tanzania
2Department of Surgery and Trauma, St. Francis University College of Health and Allied Sciences, Ifakara, Tanzania
3Center for Evolutionary Hologenomics, GLOBE Institute, University of Copenhagen, København, Denmark
Corresponding author: Philbert Balichene Madoshi Department of Public Health, St. Francis University College of Health and Allied Sciences, P. O. Box 175, Mlabani Road, Ifakara, Tanzania Email: bmadoshi@gmail.com
Received 2025 December 12; Revised 2026 January 26; Accepted 2026 March 1.

Abstract

Purpose

Antimicrobial resistance (AMR) is making urinary tract infections (UTIs) and surgical site infections (SSIs) increasingly difficult to treat, especially in low-resource settings where self-medication and limited laboratory services are common. This study explored knowledge and practices related to AMR and investigated Pseudomonas aeruginosa from clinical and environmental reservoirs in Kilombero, rural Tanzania.

Materials and Methods

A cross-sectional study was conducted over 9 months at St. Francis Regional Referral Hospital and selected community markets. Questionnaires were used to assess AMR awareness and antibiotic-use practices among community members and healthcare providers. Urine samples from pregnant women, SSI swabs, and fresh fish samples were collected. Fish were included as indicators of environmental reservoirs and possible foodborne exposure to P. aeruginosa. Presumptive isolates were confirmed using polymerase chain reaction targeting the OprI and OprL genes. Antimicrobial susceptibility testing followed EUCAST (European Committee on Antimicrobial Susceptibility Testing) 2021 guidelines.

Results

Only 34% of community participants correctly identified bacteria as causes of infection, while 19% had no knowledge of bacterial infections or AMR. Ciprofloxacin was the most commonly used antibiotic (49%), and self-diagnosis was frequently reported (35%), particularly among fish vendors. Poor hygiene practices, including hand-washing without soap, were also common. A total of 271 P. aeruginosa isolates were confirmed. Gentamicin showed the highest effectiveness across all sample sources, while resistance to meropenem and ciprofloxacin was substantial, especially among fish and SSI isolates.

Conclusions

Knowledge gaps, self-medication, and inconsistent hygiene coexist with the presence of P. aeruginosa in both clinical samples and fish representing environmental reservoirs Tanzania. Improved diagnostics, antimicrobial stewardship, hygiene practices, and community education are needed to strengthen AMR control using a One Health approach.

HIGHLIGHTS

Pseudomonas aeruginosa is a multisource bacterium which included: clinical samples represented by urine and surgical site infections and environmental samples presented by fresh fish, indicating widespread environmental and human reservoirs in rural Tanzania. High levels of resistance to commonly used antibiotics were observed, raising concerns for treatment efficacy and antimicrobial stewardship. Findings underscore interconnected human-food transmission pathways, supporting integrated surveillance and control strategies.

INTRODUCTION

Pseudomonas aeruginosa is a gram-negative bacterium widely distributed in the environment and recognized as an important opportunistic pathogen. It exhibits intrinsic resistance to many commonly prescribed antibiotics and disinfectants, complicating its management in both hospital and community settings [1,2]. The species has a relatively large genome (5.5–7 Mbp) consisting of a highly conserved core and a variable accessory genome. This genomic plasticity contributes to its remarkable metabolic capacity and supports horizontal gene transfer (HGT), allowing it to acquire and disseminate antimicrobial resistance (AMR) determinants across microbial communities [3-5].

Because of these traits, P. aeruginosa has become a major cause of healthcare-associated infections, including surgical site infections (SSIs), urinary tract infections (UTIs), and ventilator-associated pneumonia. In Tanzania, P. aeruginosa has been repeatedly reported among the most common multidrug-resistant pathogens isolated from hospital settings. Manyahi et al. [6] documented rising AMR trends in bloodstream infections at Muhimbili National Hospital, where P. aeruginosa showed resistance to cephalosporins and carbapenems. Earlier, Subedi et al. [7] and Pang et al. [8] had highlighted its role in nosocomial infections, while Moremi et al. [9] and Hokororo et al. [10] further confirmed its significance in urinary and wound infections. Collectively, these findings underscore its persistence in Tanzanian hospitals as a pathogen of concern.

Outside clinical settings, P. aeruginosa is widespread in water, soil, and food, with fish and other aquatic products serving as potential environmental reservoirs and routes of human exposure [11-13]. This is especially relevant in Tanzania’s Kilombero Valley, where close human- animal-environment interactions are common. Despite its importance, community-associated P. aeruginosa infections remain poorly understood in many low- and middle-income countries. The challenge is intensified by irrational antimicrobial use, including self-prescription, incomplete dosing, and easy over-the-counter access [14-17]. These behaviors promote the emergence and persistence of resistant strains. Addressing this requires integrated efforts combining hospital surveillance, community education, and environmental monitoring.

Accurate identification of P. aeruginosa is essential for effective surveillance, diagnosis, and infection control. Conventional biochemical methods, including oxidase testing, motility assessment, and pigment production, remain valuable for preliminary identification. However, molecular confirmation techniques offer higher sensitivity and specificity for accurate detection of the organism. In this study, isolates were characterized using the outer membrane lipoprotein I (OprI) and peptidoglycan-associated lipoprotein (OprL) gene makers for genus and species-specific level confirmation of P. aeruginosa [12,13]. Incorporating molecular methods enhances the accuracy of reporting and provides reliable evidence that can be used both locally and globally to inform AMR monitoring efforts.

This study investigated the prevalence and resistance profiles of P. aeruginosa isolated from SSIs, urine samples from pregnant women, and fish collected in the Kilombero Valley. By combining clinical, community, and environmental data, it aimed to shed light on transmission pathways beyond hospitals and document antimicrobial use practices, including inappropriate access and self-medication. The findings address key local knowledge gaps and support the World Health Organization’s call for evidence on multidrug-resistant priority pathogens. Ultimately, the results will inform Tanzania’s National Action Plan on AMR (2023–2028) by strengthening stewardship, infection prevention, and policy efforts to limit the spread of resistant P. aeruginosa.

MATERIALS AND METHODS

1. Study Area and Design

The study was conducted in Kilombero District in South-Eastern Tanzania. The Kilombero Valley is characterized by an extensive wetland system fed by the Kilombero River and its tributaries. Its low-lying location below sea level makes it one of the most humid regions in the country, creating ecological conditions that support close interactions between humans, animals, and the environment. A cross-sectional study was carried out over 9 months (January–September 2025). Samples were collected from 3 main sources: (1) patients with SSIs, (2) pregnant women attending antenatal clinics, and (3) fresh fish sold at local markets.

2. Sample Size Determination and Isolation Procedures

The sample size was determined using a 95% confidence level (Z=1.96), an assumed prevalence of 50% for P. aeruginosa resistance due to limited baseline data, and a margin of error of 5%, giving a minimum required sample size of 384 specimens. To increase statistical power and account for possible losses during microbiological and molecular analyses, the final target was rounded to 400 specimens. These comprised 150 SSI swab specimens, 200 urine specimens from pregnant women, and 50 fresh fish specimens collected from local markets. Fish samples were included to represent environmental reservoirs and potential foodborne exposure pathways for P. aeruginosa. The calculated sample size referred to the number of biological specimens collected and not the final number of bacterial isolates recovered. During microbiological culture, a single specimen could yield more than one presumptive P. aeruginosa isolate because multiple colonies with similar or distinct morphological characteristics could be present within the same sample. To improve detection of strain diversity and AMR patterns, up to three presumptive colonies from a single specimen were subcultured and analyzed separately.

3. Study Participant Recruitment and Sampling Strategy

Participants for the questionnaire survey were recruited from groups involved in healthcare delivery, antimicrobial use, and laboratory diagnostics within the study area. These included pregnant women attending antenatal clinics, medical students, drug prescribers, drug dispensers, laboratory technicians, and fish vendors. A purposive and convenience sampling strategy was used to recruit participants who were readily available and directly involved in activities related to antimicrobial use and infection control. Pregnant women attending antenatal clinics and patients with SSIs were recruited consecutively during the study period. On the other hand, fish vendors were recruited in the local market where they always sell the fish. The overall positive response rate of the participants in all categories was 95% of the target population.

4. Inclusion and Exclusion Criteria

Inclusion criteria included individuals aged 18 years or older who belonged to one of the targeted participant groups and were willing to provide informed consent. Individuals who declined participation or were unable to complete the questionnaire were excluded. A total of 424 participants completed the questionnaire. Nonparticipation was mainly due to lack of time or refusal, resulting in a high response rate among eligible individuals approached.

5. Clinical Sampling

1) Urine samples from pregnant women

Urine samples were collected from apparently healthy pregnant women attending Maternal and Child Health clinics at St. Francis Referral Hospital in Ifakara. Eligible participants were provided with sterile containers and instructed to collect midstream urine samples. Only women who provided written informed consent were included. Pregnant women were included in the study because pregnancy increases susceptibility to bacteriuria and UTIs. In addition, antenatal clinics provide an opportunity for systematic and standardized urine sample collection, while the presence of resistant uropathogens in this population has important implications for maternal and neonatal health outcomes and antimicrobial stewardship (AMS).

2) Surgical site infections

SSI samples were planned to be obtained from patients whose surgical wounds showed clinical signs of infection at least 72 hours after surgery. A SSI was defined as an infection occurring at or near the surgical incision within 30 days of surgery, or within 90 days for implant-related procedures. Swabs were collected under aseptic conditions by trained healthcare personnel. Patients with fresh wounds or infections attributed to non-surgical causes were excluded. The calculated sample size for the SSI component was 150 patients. However, the actual number of enrolled participants was 14 during the study period. This difference reflects the application of strict eligibility criteria, particularly the requirement for clinically confirmed postoperative infections occurring ≥ 72 hours after surgery, as well as participant consent considerations.

Given these constraints, the SSI component was implemented as an exploratory subgroup within the broader study. The reduced sample size was anticipated to limit statistical power; therefore, analyses involving SSI data were interpreted descriptively and with caution. Included SSI cases comprised clean-contaminated and contaminated wounds, mainly from abdominal and obstetric procedures, representing the most common surgical infection types observed at the study facility.

3) Fish samples

Environmental reservoirs were represented by fresh fish purchased from local vendors in Ifakara Township. Sterile swabs were taken from fish surfaces and immediately inoculated into double-strength nutrient broth to preserve bacterial viability. Only freshly caught fish were included in the study; frozen fish and fish sourced from lakes or oceans were excluded.

4) Sample collection and processing

Fresh fish samples were swabbed from 3 anatomical sites: the outer surface, gills, and intestines. For human samples, approximately 5 mL of midstream urine was self-collected in sterile containers, stored at 4°C, and processed within 6 hours. SSI swabs were collected aseptically by trained healthcare personnel. All samples (fish swabs, SSI swabs, and urine) were first enriched in peptone water broth and incubated for 24 hours, followed by subculture on cetrimide agar for selective isolation of P. aeruginosa. Presumptive isolates were identified based on standard phenotypic characteristics, including motility, positive oxidase and catalase reactions, gelatin hydrolysis, arginine dihydrolase activity, citrate utilization, and growth at 42°C, following established laboratory protocols.

To enhance representativeness while minimizing duplication, 2 to 3 morphologically distinct colonies were selected from each positive fish and SSI sample for further processing. For urine samples, where growth was typically more homogeneous, one representative colony per positive culture was selected. Each selected colony was treated as a presumptive isolate and subjected to further confirmation and antimicrobial susceptibility testing. Where multiple colonies from a single sample exhibited similar morphology, only one isolate was included in the final analysis to avoid overrepresentation. Conversely, morphologically distinct colonies were processed separately to capture potential within-sample diversity. For the SSI subgroup, given the limited number of enrolled patients, all eligible isolates meeting the selection criteria were included in the analysis. All confirmed isolates were stored at -20°C prior to downstream analyses.

6. Molecular Confirmation of P. aeruginosa

Presumptive P. aeruginosa isolates were refreshed in tryptone/tryptic soy broth for 6 hours at 37°C and subsequently subcultured on blood agar plates for 18 hours at 37°C. Genomic DNA was extracted from biochemically confirmed isolates and the reference strain P. aeruginosa ATCC 27853 using the Quick-DNA Miniprep Kit (Zymo Research Corp., USA), according to the manufacturer’s instructions. Species confirmation was performed by polymerase chain reaction (PCR) targeting the OprI gene, a genus marker for Pseudomonas, and the OprL gene, a species-specific marker for P. aeruginosa, following the protocol described by De Vos et al. [13].

Each 25-μL PCR reaction contained PCR master mix, forward and reverse primers, nuclease-free water, and 5 μL of template DNA. Amplification was performed in a thermocycler under the following conditions: initial denaturation at 95°C for 5 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing at 58° C for 30 seconds, and extension at 72°C for 45 seconds, with a final extension at 72°C for 5 minutes. PCR products were separated by electrophoresis on a 1.5% agarose gel at 100 V for approximately 40 minutes, stained, and visualized under ultraviolet illumination. Fragment sizes were determined using a 100-bp DNA ladder. Positive (P. aeruginosa ATCC 27853) and negative controls were included in all PCR runs. The primer sequences adopted in this confirmation are presented in Table 1.

Set of primers used to confirm Pseudomonas isolates

7. Antimicrobial Susceptibility Testing

Antimicrobial susceptibility testing was performed using the Kirby-Bauer disk diffusion method described by Bauer et al. [18] and interpreted according to European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines [19]. The antibiotics tested were ciprofloxacin (5 μg), gentamicin (10 μg), meropenem (10 μg), and ceftriaxone (5 μg). These agents were selected to represent commonly used antimicrobial classes in the study setting. Ceftriaxone was included to reflect local empirical prescribing practices, where it is frequently used for the treatment of severe infections despite its limited activity against P. aeruginosa, particularly in situations where antimicrobial susceptibility testing is not routinely performed. For testing, isolates were subcultured on blood agar and incubated at 37°C for 24 hours. Three to 5 colonies from each plate were suspended in sterile distilled water and adjusted to 0.5 McFarland turbidity. The suspension was evenly inoculated onto Mueller- Hinton agar plates, after which antibiotic discs were applied. Plates were incubated at 37°C for 18–24 hours. The zones of inhibition were measured using a Vernier caliper, and results were interpreted using EUCAST breakpoint criteria to classify isolates as susceptible or resistant.

8. Questionnaire Survey

A structured questionnaire was administered to collect information on participants’ awareness of UTI and SSI symptoms, perceived causes of infection, diagnostic practices, and commonly used treatments. Additional health and behavioral questions were included to contextualize AMR patterns. Participants included 200 pregnant women, 100 medical students, 14 SSI patients, 20 fish vendors, 30 drug prescribers, 40 drug dispensers, and 20 laboratory technicians from years 2 to 5 were randomly selected. Medical students were included because, they are the future healthcare providers, their knowledge and practices are expected to influence prescribing behavior, infection control, and AMS efforts in Tanzania.

9. Data Analysis

Data were entered into Microsoft Excel (Microsoft Corp., USA), cleaned, and analyzed using Epi Info (Centers for Disease Control and Prevention, USA). Continuous variables were summarized using means and standard deviations, while categorical variables were presented as frequencies and percentages. Differences between groups were assessed using the chi-square test. When the assumptions for the chi-square test were not met, Fisher exact test or the Mann-Whitney U-test was applied as appropriate. Antimicrobial susceptibility patterns across sample sources were compared using 2×3 chi-square tests, and Wilson 95% confidence intervals (CIs) were calculated for proportions. To examine factors associated with self-medication practices, bivariate analysis was conducted using 2×2 contingency tables, and crude odds ratios (ORs) with 95% CIs were calculated. These comparisons assessed differences in self-medication among selected participant groups, including fish vendors, pregnant women, and medical versus nonmedical participants. A p-value <0.05 was considered statistically significant.

RESULTS

The study combined a questionnaire survey with laboratory analysis of specimens collected from clinical and environmental sources. A total of 400 biological specimens were targeted during study planning, including urine specimens from pregnant women, SSI swab specimens, and fresh fish samples. However, the number of eligible patients with confirmed SSIs presenting during the study period was lower than anticipated, resulting in fewer SSI specimens being collected than initially planned.

Overall, 271 P. aeruginosa isolates were confirmed by PCR and included in the final analysis. These comprised 144 isolates (53.1%) from urine specimens of pregnant women, 85 isolates (31.4%) from fish-derived environmental specimens, and 42 isolates (15.5%) from SSI specimens. The 42 SSI isolates were recovered from 14 patients with confirmed SSIs. During laboratory processing, multiple presumptive P. aeruginosa colonies were isolated from a single clinical specimen; therefore, up to three isolates from each SSI specimen were subcultured and analyzed separately to capture potential strain diversity and AMR variation within individual patient samples. Consequently, the 42 SSI isolates do not represent 42 independent patients but rather multiple isolates recovered from 14 SSI specimens. In addition, 424 participants completed a structured questionnaire assessing knowledge, attitudes, and practices related to antimicrobial use, self-medication, hygiene, and awareness of bacterial infections and AMR.

1. Community Knowledge, Care-Seeking, and Treatment for UTIs

Knowledge of UTI causative agents varied significantly across participant groups (Table 2). Most nonmedical respondents were unable to name specific pathogens, reporting “bacteria” (34%) or “don’t know” (19%). Among medical participants, Escherichia coli was the most frequently cited pathogen (26%), while Staphylococcus aureus (8%) and P. aeruginosa (4%) were rarely mentioned. Ciprofloxacin was the most commonly reported treatment (49%), followed by amoxicillin-clavulanic acid (21%), while gentamicin (13%) and ceftriaxone (6%) were less frequently cited. Diagnosis was largely informal, with 35% of respondents reporting self-diagnosis and only 15% seeking care at hospitals or 14% at registered laboratories. Microscopy (28%) was the most commonly cited diagnostic method, while culture-based testing was rarely reported. A summary of the results presented in this section is provided in Table 2.

Participant’s responses on pathogens, drugs, and diagnosis of UTIs

2. Participants’ Responses on IPC Practices, Stewardship Awareness, and Self-medication

Infection prevention and control (IPC) practices differed significantly across participant groups (chi-square test, p<0.001). Pregnant women (53.3%), SSI patients (80%), and fish vendors (60%) most frequently reported washing hands without soap, indicating suboptimal hygiene practices. In contrast, laboratory technicians (80%) and drug prescribers (50%) more commonly reported using soap or hand sanitizers, reflecting better adherence to recommended IPC practices. The results of this section are summarized in Table 3.

Participants’ responses on IPC, self-medication and AMR stewardship practices

Self-medication practices also varied across groups. The highest prevalence was observed among fish vendors (80%), followed by pregnant women (53.3%) and SSI patients (40%). Bivariate analysis showed that fish vendors had significantly higher odds of self-medication compared with other participants combined (OR, 3.41). In contrast, no meaningful difference was observed between medical and nonmedical participants (OR, 0.88). Awareness of AMS also differed significantly across groups (p<0.001). Nonmedical participants frequently reported having no formal source of stewardship information, whereas medical cadres commonly cited standard treatment guidelines and prescription forms as their primary sources of guidance. Table 4 summarizes the factors associated with self-medication among study participants.

Factors associated with self-medication

3. Biochemical and Molecular Confirmation of Bacterial Isolates

A total of 400 samples were collected from clinical and environmental sources, including fish, urine samples from pregnant women, and SSI specimens. After culture and biochemical screening, 295 isolates were identified as presumptive P. aeruginosa. These isolates were then confirmed using PCR targeting 2 markers: OprI, a genus-level marker for Pseudomonas, and OprL, a species-specific marker for P. aeruginosa. Of the 295 isolates, 282 (95.6%) were positive for OprI and 271 (91.9%) were positive for OprL. Only isolates positive for both genes were retained, yielding 271 confirmed P. aeruginosa isolates for analysis as shown in Table 5. In addition, Fig. 1 shows the agarose gel electrophoresis results of PCR amplification and molecular confirmation of P. aeruginosa isolates.

Conventional and molecular identification of bacterial isolates

Fig. 1.

Agarose gel electrophoresis showing polymerase chain reaction (PCR) amplification of the OprL (504 bp) and OprI (249 bp) genes used for molecular confirmation of Pseudomonas aeruginosa isolates. Lane L: 100–1,500 bp DNA ladder; Lane 1: negative control (PCR mixture without DNA template); Lanes 2–6: positive P. aeruginosa isolates showing amplification of the target genes; Lane 7: positive control using a reference strain of P. aeruginosa.

4. Antimicrobial Susceptibility Patterns

Marked differences in AMR were observed between environmental (fish) and clinical (urine and SSI) isolates (Table 6). Ciprofloxacin resistance was highest among SSI isolates (34 of 42, 81.0%), followed by fish isolates (57 of 85, 67.1%) and urine isolates (50.0%) (χ²=9.6, p=0.008). Meropenem resistance was highest in fish isolates 78 of 85 (91.8%), compared with SSI isolates (29 of 42, 69.1%) and urine isolates (44.4%) (χ²=38.2, p<0.001). Ceftriaxone resistance was near universal across all sources, with resistance rates of 88.2% in fish isolates and 100% in both urine and SSI isolates (p<0.001), indicating very limited clinical utility. Gentamicin showed the highest overall effectiveness, with susceptibility rates of 88.9% in urine isolates, 80.0% in fish isolates, and 73.8% in SSI isolates (p=0.03). Correspondingly, resistance was highest in SSI isolates (11 of 42, 26.2%), followed by fish isolates (17 of 85, 20.0%) and urine isolates (16 of 144, 11.1%). Overall, antimicrobial susceptibility patterns varied significantly by source of isolation, with environmental isolates demonstrating particularly high resistance to meropenem, and SSI isolates showing elevated resistance to ciprofloxacin and gentamicin. The detailed distribution of susceptibility and resistance is presented in Table 6. In addition, Fig. 2, shows the antimicrobial susceptibility patterns of P. aeruginosa isolates among samples

Antimicrobial sensitivity test of 271 Pseudomonas aeruginosa isolates

Fig. 2.

Antimicrobial susceptibility patterns of Pseudomonas aeruginosa isolates from fish, surgical site infections (SSI), and urine samples.

DISCUSSION

This study integrates community knowledge, clinical practice, and laboratory evidence to characterize drivers of UTI management and AMR in a rural Tanzanian setting. Three key themes emerged: (1) substantial knowledge and diagnostic gaps among community members, (2) uneven infection prevention and AMS practices with heavy reliance on self-medication, and (3) laboratory confirmation of P. aeruginosa across clinical and environmental samples with variable susceptibility to commonly used antibiotics. Together, these findings highlight the interconnected biological, behavioral, and health system factors sustaining AMR in low-resource contexts.

1. Knowledge and Diagnosis of UTIs in Global Context

Knowledge regarding the causes of urinary tract infections (UTIs) was generally limited among nonmedical participants, with many respondents unable to identify specific bacterial pathogens. Similar findings have been reported in Tanzania and other low- and middle-income countries (LMICs), where limited awareness of infectious diseases and restricted access to diagnostic services contribute to inappropriate healthcare-seeking behavior and empiric antibiotic use [17,20-24]. Although medical participants were more likely to identify Escherichia coli as a common uropathogen, awareness of other clinically important organisms, including P. aeruginosa, remained low.

The findings also revealed heavy reliance on self-diagnosis and limited utilization of laboratory-based diagnostics. This pattern is concerning because accurate diagnosis is essential for appropriate antimicrobial selection and effective stewardship. The World Health Organization (WHO) has emphasized that strengthening diagnostic capacity is a key component of AMR control, particularly in resource-constrained settings where empirical prescribing remains common [25]. Limited access to culture and susceptibility testing may contribute to inappropriate antibiotic use and accelerate the emergence of resistant pathogens.

2. Treatment Patterns and Self-medication Across Regions

Ciprofloxacin was the most frequently reported antibiotic used by participants, and self-medication was common, particularly among fish vendors. Similar patterns of inappropriate antibiotic use have been documented in Tanzania and elsewhere in sub-Saharan Africa, where antibiotics are often obtained without prescriptions and used without microbiological confirmation [21,25-28]. Self-medication may be driven by financial constraints, perceived convenience, previous treatment experiences, and inadequate access to healthcare facilities. The high prevalence of self-medication observed in this study raises concerns regarding inappropriate antibiotic exposure and selection pressure for resistant organisms. Previous studies have demonstrated that irrational antimicrobial use contributes significantly to the emergence and dissemination of AMR in both healthcare and community settings [17,23,29]. These findings underscore the need for community-targeted stewardship interventions, improved public awareness, and stronger regulation of antibiotic dispensing practices.

3. IPC, Stewardship Practices, and Global Stewardship Standards

Poor hand hygiene practices were common among nonclinical participants, particularly pregnant women and fish vendors. Inadequate hand hygiene has consistently been associated with increased transmission of infectious agents and antimicrobial-resistant organisms. Previous studies in Tanzania have similarly reported challenges in adherence to IPC measures among both healthcare workers and community populations [14,23]. The WHO identifies hand hygiene as one of the most effective interventions for preventing infection transmission and reducing healthcare-associated infections [30-33]. The findings suggest that community-based IPC interventions should complement facility-based stewardship programs. Educational campaigns focusing on hand hygiene, food handling practices, and infection prevention may contribute to reducing both infection rates and antibiotic consumption within the community.

4. P. aeruginosa in Fish: Contamination or Ecological Reservoir?

A major finding of this study was the detection of P. aeruginosa in urine specimens, surgical site infections, and fish samples. The occurrence of P. aeruginosa across multiple ecological niches supports its recognized role as both an opportunistic pathogen and an environmental organism capable of persisting in diverse habitats [1,12,34]. The recovery of isolates from fish suggests that environmental reservoirs may contribute to the maintenance and dissemination of resistant organisms within the community. Previous studies have demonstrated that aquatic environments can serve as important reservoirs of P. aeruginosa and other resistant bacteria [12]. Exposure to wastewater, agricultural runoff, and other sources of environmental contamination may facilitate bacterial persistence and the exchange of resistance determinants through horizontal gene transfer [4,5,35]. Although this study did not investigate transmission pathways directly, the findings reinforce the importance of incorporating environmental surveillance into national AMR monitoring frameworks.

5. Susceptibility Patterns and Global Clinical Implications

Antimicrobial susceptibility testing revealed substantial resistance to ciprofloxacin, meropenem, and ceftriaxone, whereas gentamicin retained comparatively higher activity across isolates from all sample sources. These findings are consistent with reports from Tanzania and other African settings describing increasing resistance among P. aeruginosa and other gram-negative pathogens [6,20,36]. The widespread resistance observed to ceftriaxone was expected because P. aeruginosa possesses intrinsic resistance mechanisms that limit the clinical effectiveness of many cephalosporins.

Particularly concerning was the high level of resistance to meropenem among environmental isolates. Carbapenems are often regarded as last-line agents for the treatment of severe infections caused by multidrug-resistant gram-negative bacteria. Increasing resistance to these agents threatens the availability of effective therapeutic options and has been identified as a global public health concern [28,29,37]. The findings highlight the need for routine antimicrobial susceptibility testing, development of local antibiograms, and implementation of stewardship interventions aimed at preserving the effectiveness of critically important antimicrobials.

6. Programmatic and Global Policy Relevance

The coexistence of resistant P. aeruginosa in human and environmental reservoirs illustrates the importance of a One Health approach to AMR control. The WHO, Food and Agriculture Organization, World Organisation for Animal Health, and United Nations Environment Programme have emphasized that AMR cannot be effectively addressed through healthcare interventions alone but requires coordinated action across human, animal, and environmental sectors [38,39]. The findings of this study support the objectives of Tanzania’s National Action Plan on Antimicrobial Resistance (2023–2028), which prioritizes surveillance, stewardship, infection prevention, and multisectoral collaboration [37]. Strengthening diagnostic services, promoting rational antimicrobial use, improving IPC practices, and integrating environmental surveillance into AMR monitoring systems may contribute substantially to reducing the burden of resistant infections.

7. Strengths and Limitations

A key strength of this study is the integration of community behavioral data with molecular identification and antimicrobial susceptibility testing across clinical and environmental samples, using a One Health approach. Limitations include the cross-sectional design, reliance on self-reported behaviors, and absence of genotypic relatedness analyses (e.g., multilocus sequence typing or whole-genome sequencing), which prevents confirmation of direct transmission between environmental reservoirs (fish) and human isolates. The heterogeneous study population may reduce comparability across groups, although it reflects real-world complexity.

CONCLUSION

Knowledge gaps, self-medication, and uneven IPC/AMS practices coexist with confirmed P. aeruginosa across human and environmental reservoirs and worrisome susceptibility patterns in clinical isolates. Pragmatic, nurse-anchored education, basic diagnostic stewardship, and integrated One Health surveillance are feasible, high-yield steps to reduce inappropriate antibiotic use and slow AMR in Tanzanian communities and hospitals.

Notes

Funding/Support

This study was funded by the Danish Fellowship Centre (DFC) under the Knowledge in Action Grant (Grant ID - 21-EC02-KU).

Research Ethics

Ethical approval was obtained from a recognized institutional ethics review committee (Ref. No. SFUCHAS/IRB/Vol.I/2023/0121). Written informed consent was obtained from pregnant women and fish vendors aged 18 years and above. The participation was voluntary, and respondents were informed of their right to withdraw at any stage without penalty. Confidentiality and anonymity were strictly maintained by using unique identification codes instead of personal identifiers, while the data were securely stored and accessible only to the research team.

Conflict of Interest

The authors have nothing to disclose.

Acknowledgments

The authors would like to acknowledge the medical officers for their administrative support, St. Francis Referral hospital staff, the fish vendors and the patients in the surgical wards for their consent to participate in the study.

Author Contribution

Conceptualization: PBM; Data curation: TAK; Formal analysis: PBM; Funding acquisition: PBM; Methodology: PBM; Project administration: SBA; Writing - original draft: PBM, TAK; Writing - review & editing: SBA.

References

1. Winsor GL, Van Rossum T, Lo R, Khaira B, Whiteside MD, Hancock RE, et al. Pseudomonas Genome Database: facilitating user-friendly, comprehensive comparisons of microbial genomes. Nucleic Acids Res 2009;37:D483–88.
2. Winsor GL, Griffiths EJ, Lo R, Dhillon BK, Shay JA, Brinkman FS. Enhanced annotations and features for comparing thousands of Pseudomonas genomes in the Pseudomonas genome database. Nucleic Acids Res 2016;44:D646–53.
3. Gholami A, Majidpour A, Talebi-Taher M, Boustanshenas M, Adabi M. PCR-based assay for the rapid and precise distinction of Pseudomonas aeruginosa from other Pseudomonas species recovered from burns patients. J Prev Med Hyg 2016;57:E81–5.
4. Madaha EL, Mienie C, Gonsu HK, Bughe RN, Fonkoua MC, Mbacham WF, et al. Whole-genome sequence of multi-drug resistant Pseudomonas aeruginosa strains UY1PSABAL and UY1PSABAL2 isolated from human broncho-alveolar lavage, Yaoundé, Cameroon. PLoS One 2020;15e0238390.
5. Treepong P, Kos VN, Guyeux C, Blanc DS, Bertrand X, Valot B, et al. Global emergence of the widespread Pseudomonas aeruginosa ST235 clone. Clin Microbiol Infect 2018;24:258–66.
6. Manyahi J, Kibwana U, Mgimba E, Majigo M. Multi-drug resistant bacteria predict mortality in bloodstream infection in a tertiary setting in Tanzania. PLoS One 2020;15e0220424.
7. Subedi D, Vijay AK, Kohli GS, Rice SA, Willcox M. Comparative genomics of clinical strains of Pseudomonas aeruginosa strains isolated from different geographic sites. Sci Rep 2018;8:15668.
8. Pang Z, Raudonis R, Glick BR, Lin TJ, Cheng Z. Antibiotic resistance in Pseudomonas aeruginosa: mechanisms and alternative therapeutic strategies. Biotechnol Adv 2019;37:177–92.
9. Moremi N, Claus H, Vogel U, Mshana SE. Surveillance of surgical site infections by Pseudomonas aeruginosa and strain characterization in Tanzanian hospitals does not provide proof for a role of hospital water plumbing systems in transmission. Antimicrob Resist Infect Control 2017;6:56.
10. Hokororo A, Kihunrwa A, Hoekstra P, Kalluvya SE, Changalucha JM, Fitzgerald DW, et al. High prevalence of sexually transmitted infections in pregnant adolescent girls in Tanzania: a multi-community cross-sectional study. Sex Transm Infect 2015;91:473–8.
11. Jumanne S, Meda J, Hokororo A, Leshabari K. Clinical predictors of malaria, acute bacterial meningitis and treatment outcomes among febrile children admitted with altered mental status in Northwestern Tanzania. J Trop Pediatr 2018;64:426–33.
12. Mena KD, Gerba CP. Risk assessment of Pseudomonas aeruginosa in water. Rev Environ Contam Toxicol 2009;201:71–115.
13. De Vos D, Bouton C, Sarniguet A, De Vos P, Vauterin M, Cornelis P. Sequence diversity of the oprI gene, coding for major outer membrane lipoprotein I, among rRNA group I pseudomonads. J Bacteriol 1998;180:6551–6.
14. Bahegwa RP, Hussein AK, Kishimba R, Hokororo J, German C, Ngowi R, et al. Factors affecting compliance with infection prevention and control standard precautions among healthcare workers in Songwe region, Tanzania. Infect Prev Pract 2022;4:100236.
15. MTaPS. Tanzania - The Medicines, Technologies, and Pharmaceutical Services (MTaPs) Program [Internet]. Arlington (VA): US Agency for International Development (USAID); 2022 [cited 2025 Jan 12]. Available from: https://www.mtapsprogram.org/where-we-work/tanzania/.
16. Tellevik MG, Blomberg B, Kommedal Ø, Maselle SY, Langeland N, Moyo SJ. High prevalence of faecal carriage of ESBL-producing Enterobacteriaceae among children in Dar es Salaam, Tanzania. PLoS One 2016;11e0168024.
17. Seni J, Mapunjo SG, Wittenauer R, Valimba R, Stergachis A, Werth BJ, et al. Antimicrobial use across six referral hospitals in Tanzania: a point prevalence survey. BMJ Open 2020;10e042819.
18. Bauer AW, Kirby WM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol 1966;45:493–6.
19. The European Committee on Antimicrobial Susceptibility Testing. Breakpoint tables for interpretation of MICs and zone diameters. Version 11.0, 2021 [Internet]. The European Committee on Antimicrobial Susceptibility Testing; 2026 [cited 2025 Jan 12]. Available from: http://www.eucast.org.
20. Silago V, Moremi N, Mtebe M, Komba E, Masoud S, Mgaya FX, et al. Multidrug-resistant uropathogens causing community acquired urinary tract infections among patients attending health facilities in Mwanza and Dar es Salaam, Tanzania. Antibiotics (Basel) 2022;11:1718.
21. Mabilika RJ, Mpolya E, Shirima G. Prevalence and predictors of self-medication with antibiotics in selected urban and rural districts of the Dodoma region, Central Tanzania: a cross-sectional study. Antimicrob Resist Infect Control 2022;11:86.
22. Zimbwe KB, Yona YJ, Chiwambo CA, Mhagama DA, Chandika AB, Kiwelu HS, et al. Antimicrobial use among outpatients at Benjamin Mkapa Hospital in Dodoma Central Zone of Tanzania: a prospective descriptive study. Infect Dis Clin Microbiol 2024;6:174–84.
23. Sangeda RZ, Kibona J, Munishi C, Arabi F, Manyanga VP, Mwambete KD, et al. Assessment of implementation of antimicrobial resistance surveillance and antimicrobial stewardship programs in Tanzanian health facilities a year after launch of the national action plan. Front Public Health 2020;8:454.
24. Katyali D, Kawau G, Blomberg B, Manyahi J. Antibiotic use at a tertiary hospital in Tanzania: findings from a point prevalence survey. Antimicrob Resist Infect Control 2023;12:112.
25. Mboya EA, Davies ML, Horumpende PG, Ngocho JS. Inadequate knowledge on appropriate antibiotics use among clients in the Moshi municipality Northern Tanzania. PLoS One 2020;15e0239388.
26. Horumpende PG, Mshana SE, Mouw EF, Mmbaga BT, Chilongola JO, de Mast Q. Point prevalence survey of antimicrobial use in three hospitals in North-Eastern Tanzania. Antimicrob Resist Infect Control 2020;9:149.
27. Sado K, Keenan K, Manataki A, Kesby M, Mushi MF, Mshana SE, et al. Treatment seeking behaviours, antibiotic use and relationships to multi-drug resistance: a study of urinary tract infection patients in Kenya, Tanzania and Uganda. PLOS Glob Public Health 2024;4e0002709.
28. Jeukens J, Freschi L, Kukavica-Ibrulj I, Emond-Rheault JG, Tucker NP, Levesque RC. Genomics of antibiotic-resistance prediction in Pseudomonas aeruginosa. Ann N Y Acad Sci 2019;1435:5–17.
29. World Health Organization. Global research agenda for antimicrobial resistance in human health Geneva (Switzerland): World Health Organization. 2024.
30. Eliakimu E. Antimicrobial stewardship in Tanzania: a consideration of strengths, weaknesses, opportunities and challenges for maintenance and further development of efforts. Int J Heal Gov 2016;21:150–64.
31. Musoke D, Lubega GB, Gbadesire MS, Boateng S, Twesigye B, Gheer J, et al. Antimicrobial stewardship in private pharmacies in Wakiso district, Uganda: a qualitative study. J Pharm Policy Pract 2023;16:147.
32. Kamere N, Garwe ST, Akinwotu OO, Tuck C, Krockow EM, Yadav S, et al. Scoping review of national antimicrobial stewardship activities in eight African countries and adaptable recommendations. Antibiotics (Basel) 2022;11:1149.
33. Gebreyes WA, Dupouy-Camet J, Newport MJ, Oliveira CJ, Schlesinger LS, Saif YM, et al. The global one health paradigm: challenges and opportunities for tackling infectious diseases at the human, animal, and environment interface in low-resource settings. PLoS Negl Trop Dis 2014;8e3257.
34. Bennion N, Mulokozi G, Allen E, Fullmer M, Kleinhenz G, Dearden K, et al. Association between WASH-related behaviors and knowledge with childhood diarrhea in Tanzania. Int J Environ Res Public Health 2021;18:4681.
35. Kibwana UO, Manyahi J, Sensa V, Yongolo SC, Lyamuya E. Predictors of surgical site infections among patients undergoing open urological surgery at a tertiary hospital, Tanzania: a cross sectional study. East Afr Health Res J 2022;6:113–8.
36. Kabanangi F, Joachim A, Nkuwi EJ, Manyahi J, Moyo S, Majigo M. High level of multidrug-resistant gram-negative pathogens causing burn wound infections in hospitalized children in Dar es Salaam, Tanzania. Int J Microbiol 2021;2021:6644185.
37. The United Republic of Tanzania, ; Ministry of Health Community Development Gender Elderly and Children. The national action plan on antimicrobial resistance 2023-2028 Geneva (Switzerland): World Health Organization. 2022.
38. World Health Organization. WHO guidelines on hand hygiene in health care Geneva (Switzerland): World Health Organization. 2009.
39. Food and Agriculture Organization of the United Nations, United Nations Environment Programme, World Health Organization, World Organisation for Animal Health. One health joint plan of action (2022‒2026): working together for the health of humans, animals, plants and the environment. Geneva (Switzerland): World Health Organization; 2022.

Article information Continued

Fig. 1.

Agarose gel electrophoresis showing polymerase chain reaction (PCR) amplification of the OprL (504 bp) and OprI (249 bp) genes used for molecular confirmation of Pseudomonas aeruginosa isolates. Lane L: 100–1,500 bp DNA ladder; Lane 1: negative control (PCR mixture without DNA template); Lanes 2–6: positive P. aeruginosa isolates showing amplification of the target genes; Lane 7: positive control using a reference strain of P. aeruginosa.

Fig. 2.

Antimicrobial susceptibility patterns of Pseudomonas aeruginosa isolates from fish, surgical site infections (SSI), and urine samples.

Table 1.

Set of primers used to confirm Pseudomonas isolates

Target gene Primer sequence (5′–3′) Amplicon size (bp) Reference
Oprl F: ATGAACAACGTTCTGAAATTCTCTGCT 249 bp [13]
R: CTTGCGGCTGGCTTTTTCCAG
OprL F: ATGGAAATGCTGAAATTCGGC 504 bp [12,13]
R: CTTCTTCAGCTCGACGCGACG

Table 2.

Participant’s responses on pathogens, drugs, and diagnosis of UTIs

Variable Responses Participant status
Pregnant women SSI patient Fish vendor Lab tech Drug prescriber Drug dispenser Medical students
UTI pathogens Bacteria 78 (35.0) 8 (57.1) 8 (40.0) 20 (100) 30 (100) 32 (80.0) 90 (90.0)
Virus 81 (41.0) 2 (14.3) 6 (30.0) 0 (0) 0 (0) 0 (0) 0 (0)
Other microbes 20 (10.0) 1 (7.1) 1 (5.0) 0 (0) 0 (0) 8 (20.0) 10 (10.0)
Do not know 21 (11.0) 3 (21.4) 5 (25.0) 0 (0) 0 (0.0) 0 (0) 0 (0)
Specific uropathogens Escherichia coli 0 (0) 0 (0) 0 (0) 11 (55.0) 26 (87.0) 25 (63.0) 86 (86.0)
Staphylococcus aureus 0 (0) 0 (0) 0 (0) 6 (30.0) 2 (7.0) 10 (25.0) 10 (10.0)
Pseudomonas aeruginosa 0 (0) 0 (0) 0 (0) 3 (15.0) 2 (6.0) 5 (12.0) 4 (4.0)
Other microbes 10 (5.0) 4 (20.0) 13 (65.0) 0 (0.0) 0 (0.0) 0 (0) 0 (0)
Do not know 190 (95.0) 16 (80.0) 7 (35.0) 0 (0.0) 0 (0.0) 0 (0) 0 (0)
UTI drugs Gentamicin 25 (13.0) 1 (7.0) 2 (10.0) 4 (20.0) 5 (25) 12 (30.0) 23 (23.0)
Ciprofloxacin 105 (53.0) 8 (57.0) 8 (40.0) 8 (40.0) 14 (70.0) 21 (53.0) 59 (59.0)
Amoxicillin-clavulanic acid 50 (25.0) 2 (14.0) 3 (35.0) 4 (20.0) 2 (10.0) 2 (5.0) 10 (10.0)
Ceftriaxone 10 (5.0) 0 (0.0) 0 (0) 4 (20.0) 9 (45.0) 5 (12.0) 8 (8.0)
Do not know 10 (5.0) 4 (22.0) 2 (10.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0)
UTI diagnosis premise Hospital 25 (13.0) 2 (14.0) 2 (10.0) 4 (20.0) 5 (25.0) 13 (33.0) 28 (28.0)
Self-diagnosis 108 (54.0) 9 (64.0) 5 (25.0) 10 (50) 22 (60.0) 20 (50.0) 61 (61.0)
Registered laboratory 67 (34.0) 4 (22.0) 2 (10.0) 6 (30.0) 3 (15.0) 7 (17.0) 11 (11.0)
UTI diagnosis technique Microscopy 40 (20.0) 0 (0) 4 (20.0) 12 (60.0) 7 (35.0) 9 (45.0) 39 (39.0)
Urinalysis stick 10 (5.0) 0 (0) 2 (10.0) 8 (40.0) 23 (65.0) 11 (55.0) 61 (61.0)
Do not know 150 (75.0) 14 (100) 14 (70.0) 0 (0) 0 (0) 0 (0) 0 (0.0)

Values are presented as number (%).

UTI, urinary tract infection; SSI, surgical site infection.

Table 3.

Participants’ responses on IPC, self-medication and AMR stewardship practices

Variable Participant status (n, %)
Pregnant women SSI patients Fish vendors Lab tech Drug prescribers Drug dispensers Medical students
Infection and prevention control
 Hand wash 107 (53.3) 16 (80.0) 12 (60.0) 4 (20.0) 0 (0) 0 (0) 44 (44.7)
 Hand - soap wash 93 (46.7) 4 (20.0) 8 (40.0) 16 (80.0) 15 (50.0) 0 (0) 40 (39.5)
 Washing soap and sanitizer 0 (0) 0 (0) 0 (0) 0 (0) 15 (50.0) 40 (100) 16 (15.8)
Self-medication
 Yes 107 (53.3) 16 (80.0) 16 (80.0) 12 (60.0) 20 (50.0) 20 (50.0) 58 (58.0)
 No 93 (46.7) 4 (20.0) 4 (20.0) 8 (40.0) 20 (50.0) 20 (50.0) 42 (42.0)
AMR stewardship
 Nurse 147 (73.3) 3 (20.0) 4 (20.0) 0 (0) 0 (0) 0 (0) 50 (50.0)
 Clinician 53 (26.7) 4 (26.7) 3 (13.3) 4 (20.0) 0 (0) 0 (0) 24 (23.7)
 STG adherence 0 (0) 0 (0) 0 (0) 0 (0) 12 (40.0) 30 (75.0) 5 (5.3)
 Not aware 0 (0) 7 (53.3) 13 (66.7) 0 (0) 0 (0) 0 (0) 11 (10.5)
 Prescription forms 0 (0) 0 (0) 0 (0) 16 (80.0) 18 (60.0) 10 (25.0) 11 (10.5)

Values are presented as number (%).

IPC, infection prevention and control; AMR, antimicrobial resistance, SSI, surgical site infection; Lab Tech, laboratory technician, STG, standard treatment guidelines.

Table 4.

Factors associated with self-medication

Comparison Self-medication
OR (95% CI) Interpretation
Yes No
Fish vendors vs. all others 16 4 3.41 (1.12–10.67) Fish vendors were >3 times more likely to self-medicate
Pregnant women vs. others 107 93 1.14 (0.67–1.40) Slightly higher than others
Medical cadres vs. nonmedical 105 85 0.88 (0.71–1.58) No significant difference

OR, odds ratio; CI, confidence interval.

Table 5.

Conventional and molecular identification of bacterial isolates

Identification methods Analytical techniques Total samples (n=400)
Positive Negative
Conventional bacteriology e.g., oxidase, motility and pigment production Phenotypic 321 (80.2) 79 (19.8)
Biochemical 295 (73.8) 105 (26.2)
Molecular analysis using conventional PCR OprI for genus-level confirmation (n=295) 282 (95.6) 14 (4.4)
OprL for species-specific confirmation (n=295) 271 (91.9) 11 (8.1)

Values are presented as number (%).

PCR, polymerase chain reaction.

Table 6.

Antimicrobial sensitivity test of 271 Pseudomonas aeruginosa isolates

Drug tested Antimicrobial status Source of isolation
p-value
Fish Urine SSI
Ciprofloxacin   Susceptible 28 (32.9) 72 (50.0) 8 (19.0) 0.008
  Resistant 57 (67.1) 72 (50.0) 34 (81.0)
Ceftriaxone   Susceptible 10 (11.8) 0 (0) 0 (0) <0.001
  Resistant 75 (88.2) 144 (100) 42 (100)
Meropenem   Susceptible 7 (8.2) 80 (55.6) 13 (30.9) <0.001
  Resistant 78 (91.8) 64 (44.4) 29 (69.1)
Gentamicin   Susceptible 68 (80.0) 128 (88.9) 31 (73.8) 0.03
  Resistant 17 (20.0) 16 (11.1) 11 (26.2)

Values are presented as number (%).

SSI, surgical site infection.